Hi,

I use the command minimap2 -t 30 -2 -I 5g -ax map-pb genome.fa sample_name.fq > aln.sample_name.sam to align sample_name.fa to referencegenome.fa. And use samtools read the sam file with samtools view aln.cy201704.sam | head. Here is the content of the first line:
m64291e_211224_041609/0/42782_42995 16 chr6 116495378 18 4S18M1D4M1D8M1I3M2I26M1D54M5I27M2I14M2I3M2I6M1I8M1I3M3I10M6S * 0 0 GTGCGCCTTTTTTATGGTTGGGTTATAGAGGGAGCCTATGAGATTTCTTGGTATTTTAGACTATTGAGTTGCCTTCCACCCTGCAGATCCCTCGCACTCCCCCGTACTGGATGTAACCCCGTGGTAGGACATGATTTTGCCTCCACCAAACTTCTCACTGTTTTCCTGGTGTATTAATCTCAGCCTCCATGGCGTCCGGTTCCAGTATGGTTT !!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!! NM:i:32 ms:i:226 AS:i:216 nn:i:0 tp:A:P cm:i:5 s1:i:52 s2:i:0 de:f:0.1122 rl:i:0

It seems that there is no header at all.

Here are the factors that I guess it might result in the consequences. First, the reference genome is 4.3G, I sent 5g for the argument -I, Is 5G not enough big? Besides, the raw data sample_name.for is convert from raw bam file by samtools samtools bam2fq sample_name.subreads.bam > sample_name.fq`, maybe some mistakes were taken in the fq in this step?

Just let me know If there is anything else you want me to provide.

Thanks for help,
Maxine